lenticrisprv2 puro vector (Addgene inc)
Addgene inc is a verified supplier 
98
Structured Review
Addgene inc
lenticrisprv2 puro vector
Lenticrisprv2 Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 517 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrisprv2+plasmid/lentiCRISPRv2+puro+(Plasmid+%2398290)/pmc13007490-34-8-10
Average 98 stars, based on 517 article reviews
Lenticrisprv2 Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 517 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrisprv2+plasmid/lentiCRISPRv2+puro+(Plasmid+%2398290)/pmc13007490-34-8-10
Average 98 stars, based on 517 article reviews
lenticrisprv2 puro vector - by Bioz Stars,
2026-09
98/100 stars
Images
Related Articles
Real-time Polymerase Chain Reaction:Article Title: Liver exerkine reverses aging- and Alzheimer's-related memory loss via vasculature. Article Snippet: AAV viral particles were purified and concentrated using Ultracentrifugation (Beckman Coulter). .. Genomic viral titers were measured using qPCR in combination with primer sets targeting the ITR sequence (FWD: GGAACCCCTAGTGATGGAGTT; REV CGGCC TCAGTGAGCGA).63 Abrogation of cerebrovascular TNAP in aged Cas9-inducible mice 5 different Alpl-targeting gRNAs and a non-targeting safe harbor control guide were first cloned into the Sequencing:Article Title: Liver exerkine reverses aging- and Alzheimer's-related memory loss via vasculature. Article Snippet: AAV viral particles were purified and concentrated using Ultracentrifugation (Beckman Coulter). .. Genomic viral titers were measured using qPCR in combination with primer sets targeting the ITR sequence (FWD: GGAACCCCTAGTGATGGAGTT; REV CGGCC TCAGTGAGCGA).63 Abrogation of cerebrovascular TNAP in aged Cas9-inducible mice 5 different Alpl-targeting gRNAs and a non-targeting safe harbor control guide were first cloned into the Control:Article Title: Liver exerkine reverses aging- and Alzheimer's-related memory loss via vasculature. Article Snippet: AAV viral particles were purified and concentrated using Ultracentrifugation (Beckman Coulter). .. Genomic viral titers were measured using qPCR in combination with primer sets targeting the ITR sequence (FWD: GGAACCCCTAGTGATGGAGTT; REV CGGCC TCAGTGAGCGA).63 Abrogation of cerebrovascular TNAP in aged Cas9-inducible mice 5 different Alpl-targeting gRNAs and a non-targeting safe harbor control guide were first cloned into the Clone Assay:Article Title: Liver exerkine reverses aging- and Alzheimer's-related memory loss via vasculature. Article Snippet: AAV viral particles were purified and concentrated using Ultracentrifugation (Beckman Coulter). .. Genomic viral titers were measured using qPCR in combination with primer sets targeting the ITR sequence (FWD: GGAACCCCTAGTGATGGAGTT; REV CGGCC TCAGTGAGCGA).63 Abrogation of cerebrovascular TNAP in aged Cas9-inducible mice 5 different Alpl-targeting gRNAs and a non-targeting safe harbor control guide were first cloned into the Article Title: Honokiol blocks tumor development and metastasis through mitochondrion-targeted effects. Article Snippet: .. Briefly, oligonucleotide pairs were annealed and cloned into Article Title: Lysine lactylation regulates ATF4-mediated stress responses under glucose starvation in canine hemangiosarcoma. Article Snippet: .. Oligonucleotides for each selected sgRNA were synthesized, annealed, and cloned into the Article Title: Integrative functional genomics analysis identifies pleiotropic genes for vascular diseases. Article Snippet: .. Corresponding oligonucleotides were synthetized by GenScript, and cloned into the Article Title: Lysine lactylation regulates ATF4-mediated stress responses under glucose starvation in canine hemangiosarcoma Article Snippet: .. Oligonucleotides for each selected sgRNA were synthesized, annealed, and cloned into the Article Title: eIF4E and Ezrin cooperate in pseudopods to drive a localized migratory translation program in acute myeloid leukemia Article Snippet: All siRNA were from IDT Technologies. siRNA duplex_Luciferase sense (CACGUACGCGGAAUACUUCGAAATG) and antisense (CAUUUCGAAGUAUUCCGCGUACGUGUU) siRNA duplex _Ezrin sense (GGAAUCAACUAUUUCGAG) and antisense (UUUUUAUCUCGAAAUAGU); siRNA duplex eIF4E: sense (CUGCGUCAAGCAAUCGAGAUUUGGG) and antisense (CCCAAAUCUCGAUUGCUUGACGCAGUC). .. MM6 and THP-1 CRISPR clones with eIF4E disruption were generated using Plasmid Preparation:Article Title: Liver exerkine reverses aging- and Alzheimer's-related memory loss via vasculature. Article Snippet: AAV viral particles were purified and concentrated using Ultracentrifugation (Beckman Coulter). .. Genomic viral titers were measured using qPCR in combination with primer sets targeting the ITR sequence (FWD: GGAACCCCTAGTGATGGAGTT; REV CGGCC TCAGTGAGCGA).63 Abrogation of cerebrovascular TNAP in aged Cas9-inducible mice 5 different Alpl-targeting gRNAs and a non-targeting safe harbor control guide were first cloned into the Article Title: Honokiol blocks tumor development and metastasis through mitochondrion-targeted effects. Article Snippet: .. Briefly, oligonucleotide pairs were annealed and cloned into Article Title: GTPase Rab11b and effector Rab11-FIP2 promote NLRP3 stability during inflammasome priming Article Snippet: .. Generation of a stable THP-1 deficient in FIP2 expression To make the THP-1 FIP2 knock out cell lines a Article Title: ZNF121 recruits YTHDF2 to modulate mRNA stability Article Snippet: .. CRISPR-mediated gene knockouts were performed using the Article Title: Lysine lactylation regulates ATF4-mediated stress responses under glucose starvation in canine hemangiosarcoma. Article Snippet: .. Oligonucleotides for each selected sgRNA were synthesized, annealed, and cloned into the Article Title: Integrative functional genomics analysis identifies pleiotropic genes for vascular diseases. Article Snippet: .. Corresponding oligonucleotides were synthetized by GenScript, and cloned into the Article Title: Lysine lactylation regulates ATF4-mediated stress responses under glucose starvation in canine hemangiosarcoma Article Snippet: .. Oligonucleotides for each selected sgRNA were synthesized, annealed, and cloned into the Article Title: eIF4E and Ezrin cooperate in pseudopods to drive a localized migratory translation program in acute myeloid leukemia Article Snippet: All siRNA were from IDT Technologies. siRNA duplex_Luciferase sense (CACGUACGCGGAAUACUUCGAAATG) and antisense (CAUUUCGAAGUAUUCCGCGUACGUGUU) siRNA duplex _Ezrin sense (GGAAUCAACUAUUUCGAG) and antisense (UUUUUAUCUCGAAAUAGU); siRNA duplex eIF4E: sense (CUGCGUCAAGCAAUCGAGAUUUGGG) and antisense (CCCAAAUCUCGAUUGCUUGACGCAGUC). .. MM6 and THP-1 CRISPR clones with eIF4E disruption were generated using Transduction:Article Title: Liver exerkine reverses aging- and Alzheimer's-related memory loss via vasculature. Article Snippet: AAV viral particles were purified and concentrated using Ultracentrifugation (Beckman Coulter). .. Genomic viral titers were measured using qPCR in combination with primer sets targeting the ITR sequence (FWD: GGAACCCCTAGTGATGGAGTT; REV CGGCC TCAGTGAGCGA).63 Abrogation of cerebrovascular TNAP in aged Cas9-inducible mice 5 different Alpl-targeting gRNAs and a non-targeting safe harbor control guide were first cloned into the Article Title: GTPase Rab11b and effector Rab11-FIP2 promote NLRP3 stability during inflammasome priming Article Snippet: .. Generation of a stable THP-1 deficient in FIP2 expression To make the THP-1 FIP2 knock out cell lines a Expressing:Article Title: GTPase Rab11b and effector Rab11-FIP2 promote NLRP3 stability during inflammasome priming Article Snippet: .. Generation of a stable THP-1 deficient in FIP2 expression To make the THP-1 FIP2 knock out cell lines a Knock-Out:Article Title: GTPase Rab11b and effector Rab11-FIP2 promote NLRP3 stability during inflammasome priming Article Snippet: .. Generation of a stable THP-1 deficient in FIP2 expression To make the THP-1 FIP2 knock out cell lines a CRISPR:Article Title: ZNF121 recruits YTHDF2 to modulate mRNA stability Article Snippet: .. CRISPR-mediated gene knockouts were performed using the Article Title: eIF4E and Ezrin cooperate in pseudopods to drive a localized migratory translation program in acute myeloid leukemia Article Snippet: All siRNA were from IDT Technologies. siRNA duplex_Luciferase sense (CACGUACGCGGAAUACUUCGAAATG) and antisense (CAUUUCGAAGUAUUCCGCGUACGUGUU) siRNA duplex _Ezrin sense (GGAAUCAACUAUUUCGAG) and antisense (UUUUUAUCUCGAAAUAGU); siRNA duplex eIF4E: sense (CUGCGUCAAGCAAUCGAGAUUUGGG) and antisense (CCCAAAUCUCGAUUGCUUGACGCAGUC). .. MM6 and THP-1 CRISPR clones with eIF4E disruption were generated using Synthesized:Article Title: Lysine lactylation regulates ATF4-mediated stress responses under glucose starvation in canine hemangiosarcoma. Article Snippet: .. Oligonucleotides for each selected sgRNA were synthesized, annealed, and cloned into the Article Title: Lysine lactylation regulates ATF4-mediated stress responses under glucose starvation in canine hemangiosarcoma Article Snippet: .. Oligonucleotides for each selected sgRNA were synthesized, annealed, and cloned into the Disruption:Article Title: eIF4E and Ezrin cooperate in pseudopods to drive a localized migratory translation program in acute myeloid leukemia Article Snippet: All siRNA were from IDT Technologies. siRNA duplex_Luciferase sense (CACGUACGCGGAAUACUUCGAAATG) and antisense (CAUUUCGAAGUAUUCCGCGUACGUGUU) siRNA duplex _Ezrin sense (GGAAUCAACUAUUUCGAG) and antisense (UUUUUAUCUCGAAAUAGU); siRNA duplex eIF4E: sense (CUGCGUCAAGCAAUCGAGAUUUGGG) and antisense (CCCAAAUCUCGAUUGCUUGACGCAGUC). .. MM6 and THP-1 CRISPR clones with eIF4E disruption were generated using Generated:Article Title: eIF4E and Ezrin cooperate in pseudopods to drive a localized migratory translation program in acute myeloid leukemia Article Snippet: All siRNA were from IDT Technologies. siRNA duplex_Luciferase sense (CACGUACGCGGAAUACUUCGAAATG) and antisense (CAUUUCGAAGUAUUCCGCGUACGUGUU) siRNA duplex _Ezrin sense (GGAAUCAACUAUUUCGAG) and antisense (UUUUUAUCUCGAAAUAGU); siRNA duplex eIF4E: sense (CUGCGUCAAGCAAUCGAGAUUUGGG) and antisense (CCCAAAUCUCGAUUGCUUGACGCAGUC). .. MM6 and THP-1 CRISPR clones with eIF4E disruption were generated using |